Research Article
Print
Research Article
Two new records of moray eels representing genera Gymnothorax and Strophidon (Actinopterygii: Anguilliformes: Muraenidae) from the Philippines
expand article infoRoxanne A. Cabebe-Barnuevo‡§, El Andro A. Obar‡, Dianne Frances A. Penuela‡, Hiroyuki Motomura|, Ricardo P. Babaran‡, Maria Celia D. Malay‡
‡ University of the Philippines Visayas, Miagao, Philippines
§ Science Education Institute, Taguig City, Philippines
| Kagoshima University Museum, Kagoshima, Japan

Corresponding author: Maria Celia D. Malay ( mdmalay@up.edu.ph )

Academic editor: Ronald Fricke
© 2023 Roxanne A. Cabebe-Barnuevo, El Andro A. Obar, Dianne Frances A. Penuela, Hiroyuki Motomura, Ricardo P. Babaran, Maria Celia D. Malay.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Cabebe-Barnuevo RA, Obar EAA, Penuela DFA, Motomura H, Babaran RP, Malay MCD (2023) Two new records of moray eels representing genera Gymnothorax and Strophidon (Actinopterygii: Anguilliformes: Muraenidae) from the Philippines. Acta Ichthyologica et Piscatoria 53: 217-226. https://doi.org/10.3897/aiep.53.108838
ZooBank: urn:lsid:zoobank.org:pub:2E55CF5D-1C86-4BC8-8AA4-E61D2F8F0E6B
Open Access

Abstract

In this study, we report the collection of moray eel species Gymnothorax nudivomer (Günther, 1867) and Strophidon dorsalis (Seale, 1917) from the Western Visayas region, Philippines. Both represent new records for the country. A single specimen of G. nudivomer measuring 619 mm total length (TL) was collected from Iloilo Fish Port Complex, Iloilo and a specimen of S. dorsalis measuring 777 mm TL was collected from the fish market of Batan, Aklan. Detailed morphological descriptions and mitochondrial cytochrome oxidase I (COI) barcode sequences are provided. A comprehensive list of geographic records for both species, as well as a list of all species representing the genera Gymnothorax and Strophidon reported in the Philippines is also provided in this report.

Keywords

new country records, moray eel, morphology, Panay Island, taxonomy

Introduction

The family Muraenidae is considered one of the more diverse eel groups, having 228 valid species belonging to 16 genera (Fricke et al. 2023). Muraenids, commonly known as moray eels, are distinct from other eels by having 1 or 2 lateral-line pores before the gill opening, posterior nostril high on the head and usually positioned before or above the eye, small and rounded gill openings, and lack of pectoral and pelvic fins (Böhlke et al. 1999).

Moray eels are widely distributed in tropical and subtropical seas. The majority of species are found in coral reefs, shallow-water rocky areas, and moderately deep habitats down to 500 m, while a few species inhabit brackish coastal waters, rivers, or anchialine caves (e.g., Chen et al. 1994; Böhlke et al. 1999; Tsukamoto et al. 2014; Quindo and Bucol 2019; Böhlke and Smith 2002; Huang et al. 2023a). In the Philippines, 83 species representing 10 genera have been reported (Jordan and Seale 1907; Herre 1923; Herre 1953; Allen and Erdmann 2012; Smith 2012; Kottelat 2013; Motomura et al. 2017; Huang et al. 2021; Smith and Böhlke 2022; Huang et al. 2023a, 2023b; Fricke et al. 2023). Recent studies described new muraenid species from Palawan (Huang et al. 2020), Cagayan (Huang et al. 2021), Negros Oriental (Huang et al. 2021), Cebu (Huang et al. 2023b), and Bohol (Huang et al. 2023a). Taking into account the abundance of reef and shallow-water habitats in the Philippine archipelago, many more new species and new records are expected to be found through ichthyological surveys.

Two new Philippine records of moray eels and their partial cytochrome oxidase I (COI) DNA sequences are reported in this study. One of the new records, Gymnothorax nudivomer (Günther, 1867), belongs to a large genus (143 valid species; Fricke et al. 2023) known for having variable body color patterns and teeth structure, anus near mid-length of the body, and dorsal fin originating before or above gill opening (Smith et al. 2019). The second new record, Strophidon dorsalis (Seale, 1917), belongs to a small genus (only five valid species; Huang et al. 2020; Fricke et al. 2023) characterized by having an extremely long, uniformly brown or variegated body, infraorbital pores 3–5, branchial pores 1–8, and a total vertebrae count of 155–213 (Huang et al. 2020). To our knowledge, 36 species of Gymnothorax and two species of Strophidon have been reported from the Philippines prior to this study (i.e., Jordan and Seale 1907; Herre 1923; Herre 1953; Smith and Böhlke 1997; Böhlke 2000; Allen and Erdmann 2012; Motomura et al. 2017; Smith et al. 2019; Huang et al. 2020, 2021; Smith and Böhlke 2022). Therefore, this study updates the inventory of marine eel species in the country and contributes to the establishment of a COI gene-sequence library for Philippine marine fishes.

Materials and methods

Fish specimens were bought directly from the Iloilo Fish Port Complex (IFPC), Iloilo Province, and the fish market in Batan, Aklan Province (Figs 1, 2). The type of fishing gear was noted if available. Curatorial protocols followed Motomura and Ishikawa (2013). Measurements were taken using digital calipers to the nearest 1 mm following the method of Böhlke and Randall (2000) and expressed as percentages in total length (TL) and head length (HL). Meristic characters were determined following the diagram of Böhlke and Randall (2000) and Huang et al. (2020). All specimens are deposited at the Museum of Natural Sciences, University of the Philippines Visayas, Miag-ao (UPVMI).

Figure 1. 

Global geographic distribution of Gymnothorax nudivomer (red star) and Strophidon dorsalis (green star).

Figure 2. 

Geographic distribution of Gymnothorax nudivomer (red dot) and Strophidon dorsalis (green dot) in Western Visayas, Philippines (the inset to Fig. 1)

The fish muscle tissue samples were collected from the nape area on the right side of the body and preserved in absolute ethanol. DNA extractions were carried out according to the instructions of the GF-1 Nucleic Acid Extraction Kit (Vivantis Technologies Sdn. Bhd, Malaysia). The combination of the forward and reverse primers below designed by Ward et al. (2005) was used to amplify the mitochondrial cytochrome c oxidase subunit I (COI) gene:

FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′

FishR1-5′TAGACTTCTGGG TGGCCAAAGAATCA3′

The 25 μL PCR reaction was composed of 18.4 μL nuclease-free water, 2.25 μL 10× buffer, 1.25 μL MgCl2 (25 mM), 0.5 μL dNTP mix (10 mM), 0.25 μL of each primer, 0.1 μL Taq DNA polymerase (Vivantis Technologies Sdn. Bhd, Malaysia), and 2 μL DNA template. The PCR thermocycling conditions used are as follows: initial step at 95°C for 2 min, 35 cycles of 94°C for 30 s (denaturation), 54°C for 30 s (annealing), and 72°C for 1 min (extension), with a final extension at 72°C for 10 min. The PCR products were visualized using 1% agarose gel with gel red. Purification of PCR products was carried out using GF-1 PCR Clean-up Kit. The genomic DNA was quantified using a MultiSkanTM Skyhigh Microplate Spectrophotometer (Thermo Fisher Scientific). The PCR products were sent to Macrogen Inc. (South Korea) for sequencing. The forward and reverse sequences were checked, trimmed, and realigned using Unipro UGENE software (Okonechnikov et al. 2012).

Results and Discussion

Family Muraenidae Rafinesque, 1810

Genus Gymnothorax Bloch, 1795

Gymnothorax nudivomer (Günther, 1867)

English common name: yellowmouth moray (Fig. 3; Table 1)

Material examined

UPVMI-03157, 619 mm TL, Iloilo Fish Port Complex (IFPC), Iloilo City, Panay Island, Philippines, 8 June 2022, R. Cabebe-Barnuevo and R.P. Babaran leg.

Morphological diagnosis and description

Body elongated, large; tapering towards caudal area. Head large; eyes moderate in size, and situated slightly closer to snout (19% of HL) than rear of lower jaw (22% of HL, see Table 1). Mouth large; snout short and blunt; anterior nostril short, tubular, and located at snout tip; posterior nostril large, elliptic, and located above and before anterior margin of eye; upper and lower jaws subequal; teeth not visible when mouth closed; teeth on both jaws uniserial, sharply pointed; anterior teeth large and triangular; posterior teeth short and serrated. Dorsal-fin base very long; its origin anterior to gill opening. Anal-fin base shorter; its origin just behind anus. Caudal fin confluent with dorsal and anal fins. Pectoral and pelvic fins absent. Gill opening moderately large and elongated; located on middle side of body. Anus moderate in size, circular, and positioned anterior to midpoint of body. Supraorbital pores 3: first pore located on snout tip, small and circular; second pore located above anterior nostril, largest in size, circular; third located above first infraorbital pore, equal in size with first pore, circular. Infraorbital pores 4, along upper jaw; first pore located below base of anterior nostril; second pore between anterior nostril and anterior margin of eye; third pore before anterior margin of eye; fourth pore located beyond posterior margin of eye. Preoperculo-mandibular pores 6, along lower jaw; all pores positioned anterior to rictus. Branchial pore 1, located along posterodorsal head anterior to gill opening, posterior to dorsal-fin origin. Teeth pointed and uniserial; intermaxillary teeth 7; median intermaxillary teeth 1; vomerine teeth absent.

Table 1.
Download as
CSV
XLSX

Morphological counts and measurements of Gymonothorax nudivomer and Strophidon dorsalis expressed in absolute and relative values.

Character G. nudivomer UPVMI-03157 S. dorsalis UPVMI-03151
Counts
Supraorbital pores 3 3
Infraorbital pores 4 4
Preoperculo-mandibular pores 6 6
Branchial pores 1 2
Vomerine teeth Absent 4
Intermaxillary teeth 7 6
Median Intermaxillary teeth 1 3
Inner maxillary teeth — 5
Inner dentary teeth — 4
Measurements. Absolute values [mm]
Total length (TL) 619 777
Head length (HL) 78 95
Measurements. Relative values [%TL]
Head length 14 12
Body depth at gill opening 10 4
Body depth at anus 8 4
Pre-dorsal length 10 8
Pre-anal length 43 43
Measurements. Relative values [%HL]
Length of upper jaw 45 32
Length of lower jaw 45 30
Snout length 19 11
Eye diameter 8 6
Interorbital width 15 7
Distance between eye and snout 19 11
Distance between eye and rear of lower jaw 22 18

Note: All measurements were rounded off to the nearest 1 mm.

Fresh coloration

Body yellow to light brown, becoming darker on caudal area; covered entirely with white spots of varying sizes; white spots on head and anterior body area very small, becoming large towards caudal area; white spots on dorsal and anal fins similar in body spots; white spots on caudal area composed of both rounded and irregular in shape; posterior margin of caudal fin white; eyes with vertical black bar; inner mouth bright yellow; gill opening black.

Color of preserved specimen

Body light brown, becoming darker on caudal area; white spots still visible; posterior margin of caudal fin white; inner mouth white; gill opening black.

Distribution

Widely distributed across the Indo–Pacific Ocean. Specific reports are summarized in Table 2.

Table 2.
Download as
CSV
XLSX

Published reports on the occurrence of Gymnothorax nudivomer and Strophidon dorsalis along with their synonyms, organized chronologically by year of publication.

Species Status Location Reference
Gymnothorax nudivomer
Muraena nudivomer Original name Zanzibar Playfair and Günther 1867
Lycodontis nudivomer Junior synonym Red Sea Dor 1984
Mozambique (Inhaca) Smith 1962
Gymnothorax xanthostomus Junior synonym Hawaiian Islands Snyder 1904
Gymnothorax insignis Junior synonym Mauritius Seale 1917
Gymnothorax nudivomer Valid name Red Sea Goren and Dor 1994; Randall and Golani 1995; Fowler and Steinitz 1956; Castle and McCosker 1986; Khalaf and Disi 1997; Golani and Fricke 2018; Smith et al. 2019
North Pacific Ocean (Hawaii; Johnston Islands) Randall et al. 1981; Uchida and Uchiyama 1986; Castle and McCosker 1986; Chave and Mundy 1994; Böhlke and Randall 2000; Mundy 2005; Randall 2007
Taiwan (Nanfangao, Hualien and Taitung counties) Chen at al. 1994; Ramos-Castro et al. 2020
Indian Ocean (Mauritius and East Africa from Zanzibar to Transkei, Mascarene Islands, Mayotte) Quéro and Saldanha 1995; Fricke 1999; Laboute and Grandperrin 2000; Böhlke and Randall 2000; Fricke et al. 2009; Fricke et al. 2011; Allaria 2016; Eudeline 2022; Smith and Böhlke 2022
Gulf of Oman Randall 1995; Böhlke and Randall 2000
New Caledonia Böhlke and Randall 2000
South Pacific Ocean (Marquesas Islands) Böhlke and Randall 2000
Australia (From Cape York to the southeastern border of Queensland) Böhlke and McCosker 2001;
Japan (Kochi Prefecture, Okinawa Islands, Osumi Islands (Iwo-jima Island and Yakushima Island), Amami-oshima Island) Nakabo 2002; Motomura et al. 2013; Jeong and Motomura 2021; Motomura and Harazaki 2017; Nakae et al. 2018; Motomura et al. 2019
Marianas Islands Myers and Donaldson 2003
Arabian Sea (Coast of Oman, Gulf of Aden, Eastern Coast of Somali) Manilo and Bogorodsky 2003
Tonga Island Randall et al. 2004
Yemen (Socotra Archipelago) Zajonz et al. 2019
Philippines (Iloilo Province) Presently reported study
Strophidon dorsalis
Gymnothorax dorsalis Original name Hongkong Seale 1917
Malaysia Böhlke 1997
Taiwan Böhlke 1997; Loh et al. 2011
South China Sea Randall and Lim 2000
Thailand (Prachuap Khiri Khan) Yoshida et al. 2013
Indian waters (Bengal Bay, West coast of India) Ray et al. 2015; Kumar et al. 2020
Pakistan Psomadakis et al. 2015
Strophidon dorsalis Valid name Taiwan (Pingtung County, Kaohsiung City) Ho et al. 2015; Huang et al. 2020
Vietnam (Nha Trang, Da Nang, Thua Thien-Hue Province) Loh et al. 2015; Huang et al. 2020
India (West Bengal Coast, Odisha) Mohapatra et al. 2016; 2021
Korea (Jindo Island) Kang et al. 2020
Philippines (Aklan Province) Presently reported study

DNA Barcode

A COI sequence fragment measuring 605 basepairs (bp) was submitted to GenBank under accession number OR214978.

Remarks

Gymnothorax nudivomer was originally described as Muraena nudivomer from the Zanzibar Archipelago by Günther (Playfair and Günther 1867). It was then widely reported as G. nudivomer distributed across the Indo–Pacific Ocean at depths of 2–271 m (Mundy 2005; Fricke et al. 2009). This species can reach up to 1800 mm in length (Böhlke and Randall 2000). In Böhlke et al. (1999), G. nudivomer was listed as one of the moray eels occurring within the western central Pacific but it was not stated if the species was collected specifically within Philippine waters. Furthermore, according to the list of reef fishes by Allen and Erdmann (2012) from the East Indies (which includes the countries of Myanmar, Thailand, Indonesia, Singapore, Malaysia, Brunei, Papua New Guinea, Solomon Islands, and the Philippines), G. nudivomer was not known to exist in the country. Finally, Herre (1953) provided a list of approximately 2145 Philippine species, however, this species was not among them. Hence, the presently reported study treats the specimen collected from Iloilo as the first report (new country record) from Philippine waters. Table 2 and Figs 1, 2 provide the geographic distribution of the species while Table 3 includes other species within the genus Gymnothorax reported in the country. Reports that did not clearly specify that the data collection occurred within the Philippines have been excluded from the list.

Table 3.
Download as
CSV
XLSX

List of species under the genera Gymnothorax and Strophidon reported in Philippine waters.

Species Reference
Genus Gymnothorax
G. angusticauda (Weber et de Beaufort, 1916) Smith et al. 2018
G. annulatus Smith et Böhlke, 1997 Smith and Böhlke 1997; Allen and Erdmann 2012; Smith 2012
G. castlei Böhlke et Randall, 1999 Allen and Erdmann 2012
G. chilospilus Bleeker, 1864 Herre 1923, 1953; Smith 2012
G. chlamydatus Snyder, 1908 Allen and Erdmann 2012
G. enigmaticus McCosker et Randall, 1982 McCosker and Randall 1982
G. favagineus Bloch et Schneider, 1801 Herre 1923, 1953; Allen and Erdmann 2012
G. fimbriatus (Bennett, 1832) Motomura et al. 2017
G. flavimarginatus (Rüppell, 1830) Herre 1923, 1953
G. fuscomaculatus (Schultz, 1953) Allen and Erdmann 2012; Smith and Böhlke 2022
G. herrei Beebe et Tee-Van, 1933 Allen and Erdmann 2012; Smith 2012; Smith and Böhlke 2022
G. isingteena (Richardson, 1845) Balisco et al. 2023
G. kidako (Temminck et Schlegel, 1846) Herre 1923, 1953
G. margaritophorus Bleeker, 1864 Herre 1953
G. meleagris (Shaw, 1795) Herre 1923, 1953
G. microstictus Böhlke, 2000 Allen and Erdmann 2012; Böhlke 2000
G. minor (Temminck et Schlegel, 1846) Wagey et al. 2015
G. monochrous (Bleeker, 1856) Allen and Erdmann 2012
G. monostigma (Regan, 1909) Allen and Erdmann 2012; Smith and Böhlke 2022
G. nudivomer (Günther, 1867) Presently reported study
G. phasmatodes (Smith, 1962) Allen and Erdmann 2012; Smith and Böhlke 2022
G. philippinus Jordan et Seale, 1907 Jordan and Seale 1907; Herre 1923; Allen and Erdmann 2012; Smith 2012
G. pictus (Ahl, 1789) Herre 1923, 1953; Smith and Böhlke 2022
G. pindae Smith, 1962 Böhlke 2000
G. polyuranodon (Bleeker, 1854) Herre 1923, 1953; Smith and Böhlke 2022
G. prionodon Ogilby, 1895 Wagey et al. 2015
G. pseudoherrei Böhlke, 2000 Allen and Erdmann 2012; Smith 2012; Böhlke 2000; Smith and Böhlke 2022
G. pseudokidako Huang, Loh et Liao, 2021 Huang et al. 2021
G. pseudothyrsoideus (Bleeker, 1853) Herre 1953; Allen and Erdmann 2012; Motomura et al. 2017; Smith and Böhlke 2022
G. punctatofasciatus Bleeker, 1863 Herre 1923, 1953; Allen and Erdmann 2012
G. richardsonii (Bleeker, 1852) Herre 1923, 1953; Smith and Böhlke 2022
G. robinsi Böhlke, 1997 Allen and Erdmann 2012; Smith and Böhlke 2022
G. rueppelliae (McClelland, 1844) Herre 1953
G. thyrsoideus (Richardson, 1845) Herre 1923, 1953
G. tile (Hamilton, 1822) Herre 1923, 1953; Allen and Erdmann 2012
G. undulatus (Lacepède, 1803) Herre 1923, 1953
G. zonipectis Seale, 1906 Herre 1923, 1953; Smith 2012
Genus Strophidon
S. dorsalis (Seale, 1917) Presently reported study
S. sathete (Hamilton, 1822) Motomura et al. 2017; Smith and Böhlke 2022
S. tetraporus Huang, Mohapatra, Thu, Chen et Liao, 2020 Huang et al. 2020

This fish is commonly known as the yellowmouth moray and can be easily identified by its tapering body form, white spots scattered throughout the body, and yellow coloration inside the mouth. Gymnothorax elegans and G. nudivomer are closely related species (Smith et al. 2019), but can easily be distinguished based on their color patterns. Gymnothorax elegans Bliss, 1883 has larger and distinct patterns of white markings throughout the body that forms into bars towards the caudal fin (i.e., fig. 13, Smith et al. 2019), in contrast to G. nudivomer, which has relatively smaller, rounded spots on the body, that becomes a larger and elongated circle towards the caudal fin (i.e., Fig. 3, this publication; fig. 24, Smith et al. 2019).

Figure 3. 

Gymnothorax nudivomer, UPVMI-03157, 619 mm TL, Iloilo Fish Port Complex (IFPC), Iloilo City, Philippines.

Family Muraenidae Rafinesque, 1810

Genus Strophidon McClelland, 1844

Strophidon dorsalis (Seale, 1917)

English common name: three-pore moray (Fig. 4; Table 1)

Material examined

UPVMI-03151, 777 mm TL, off Batan, Aklan Province, Panay Island, Philippines, bottom set gillnet, 31 May 2021, Sunshine Sucgang leg.

Morphological diagnosis and description

Body elongated and cylindrical, becoming compressed behind anus towards tail area. Head moderately long with wrinkled skin. Eyes moderate in size, and situated closer to snout (11% of HL) than rear of lower jaw (18% of HL, see Table 1). Mouth large; snout short and blunt; anterior nostril located at snout tip, short and tubular; posterior nostril located above anterior margin of eye, large and circular; upper jaw slightly more pronounced relative to lower jaw; teeth on both jaws sharply pointed. Dorsal-fin base very long; origin anterior to gill opening. Anal-fin base shorter; origin just behind anus. Caudal fin slightly damaged but still visibly connected with dorsal and anal fins. Pectoral and pelvic fins absent. Gill opening moderately large and elongated; located on lower portion of body. Anus moderate in size, circular, and positioned anterior to midpoint of body. Supraorbital pores 3: first pore located on snout tip, small and circular; second pore located above anterior nostril; third located above first infraorbital pore, largest in size and somewhat elongated circular pore. Infraorbital pores 4, located along upper jaw; first pore located below base of anterior nostril; second pore between anterior nostril and anterior margin of eye; third pore below ventral margin of eye; fourth pore located beyond posterior margin of eye. Preoperculo-mandibular pores 6, located along lower jaw; all pores positioned anterior to rictus. Branchial pores 2, located along postero-dorsal head anterior to gill opening. Teeth on both jaws pointed; intermaxillary teeth 6; median intermaxillary teeth 3; inner maxillary teeth 5; vomerine teeth 4; inner dentary teeth 4.

Figure 4. 

Strophidon dorsalis, UPVMI-03151, 777 mm TL, off Batan, Aklan, Philippines.

Fresh coloration

Body brown becoming dark towards caudal area; margins of dorsal and anal fins dark brown; caudal fins dark brown to black.

Color of preserved specimen

Body uniformly dark brown; fins dark brown to black.

Distribution

Tropical to subtropical Indo–West Pacific Ocean. Specific reports are summarized in Table 2.

DNA Barcode

A 568 bp COI sequence fragment was submitted to GenBank under accession number OR214977.

Remarks

Strophidon dorsalis was originally placed in the genus Gymnothorax by Seale (1917) based on collections from Hong Kong. However, Loh et al. (2015) suggested that Gymnothorax dorsalis belongs to the genus Strophidon based on molecular data and similarities in some morphological features. Following the work of Loh et al. (2015), S. dorsalis was reported from Taiwan (Ho et al. 2015; Huang et al. 2020), Vietnam (Loh et al. 2015; Huang et al. 2020), India (Mohapatra et al. 2016, 2021), and Korea (Kang et al. 2020). Based on the report of Böhlke (1997), this species can be found in depths down to 110 m. The largest recorded specimen, measuring 1262 mm TL, collected from Vietnam was reported by Huang et al. (2020). Randall and Lim (2000) included Gymnothorax dorsalis on their list of fishes from the South China Sea which covers Taiwan, the Philippines, and Borneo. However, it was not specified whether the specimen was collected in Philippine waters. As a result, this study confirms the presence of the species in the Philippine waters. Table 2 provides a list of all published geographic records of the species while Table 3 includes other species within the genus Strophidon reported in the country.

This species can be distinguished from its congeners based on the following combination of characters: body uniformly brown, anus located anterior to the midpoint of the body, 3–4 infraorbital pores, 2–7 inner maxillary teeth, 3–5 inner dentary teeth, 62–73 pre-anal vertebrae, and 155–174 total vertebrae (Böhlke and Smith 2002; Huang et al. 2020). Strophidon dorsalis and S. sathete (Hamilton, 1822) are considered sister species (Loh et al. 2015). Based on the summarized morphological comparisons of the species under the genus Strophidon given by Huang et al. (2020), they have overlapping meristic counts which include infraorbital pores (both 3–4), supraorbital (both 3), preoperculo-mandibular (5–7 vs. 6–7), branchial pores (2–6 vs. 2–7), and pre-anal vertebrae (62–73 vs. 73–82). Moreover, these two species have unpatterned body coloration, short snouts, and an anus located before body mid-length. However, S. dorsalis can further be distinguished from S. sathete based on the number of teeth on the inner maxillary (2–7 vs. 10–15), teeth on the inner dentary (3–5 vs. 6–11), and total vertebrae (155–174 vs. 187–213). The specimen used in the study was initially identified as S. dorsalis based on the number of infraorbital pores (4) and fewer teeth on the lower jaw, and this was supported by the generated COI sequence.

Conclusions and recommendations

The presently reported study provides two new country records of moray eels, Gymnothorax nudivomer and Strophidon dorsalis, from Philippine waters. Additionally, a list of geographic records for both species is provided, along with the list of all species under the two genera Gymnothorax and Strophidon documented in the country. The morphological descriptions and mitochondrial cytochrome oxidase I (COI) barcode sequences provided will aid in the more accurate identification of these species. Moreover, the findings expand our understanding of the distribution of these species and contribute to ongoing efforts to establish a comprehensive genetic library for marine fish species in the Philippines.

Due to a lack of studies, there are still many unreported marine fish species from the Philippines. Some of the recently reported species are presumed to have been overlooked because they share local names with similar-looking species. One of the best examples is the local name for all species of Strophidon found in Western Visayas, which is “nipa-nipa”. Therefore, we recommend assigning specific local names (standard names) to these newly-reported species to increase public awareness of their occurrence within the country, and help the scientific community distinguish between species. However, assigning Philippine local names requires additional research, including an updated compilation of all moray eels found in the country and their respective local names.

Acknowledgments

We gratefully acknowledge funding support from the UP System Emerging Inter-Disciplinary Research Program (OVPAA-EIDR-C08-011-R), the Leverage Fund from the Office of the Vice Chancellor for Research and Extension (OVCRE), University of the Philippines Visayas (2020-13-SP), and the Comission on Higher Education (CHED). We thank the Department of Agriculture, Bureau of Fisheries and Aquatic Resources (DA-BFAR), Provincial Government Unit, and the Office of Provincial Agriculture (PAO) from Aklan Province especially Ms. Grace-an Villareal Perlas (Aklan PAO staff), Sunshine Sucgang (field enumerator of the project), and BFAR staff at Iloilo Fish Port Complex (IFPC) for their administrative support, generous assistance and contributions throughout project. We are also grateful to the Philippine Genome Center-Visayas Satellite Facility (PGC-VSF), the National Institute of Molecular Biology and Biotechnology (UPV-NIMBB), and the UPV Museum of Natural Sciences (UPV-MNS). Our gratitude and appreciation to E. Delloro Jr., K.D. Barnuevo, M.V. Aranjuez, N. Ylaron, D. Mediodia, L. Mooc, C. Garinggan, J. Ariñez, A.G. Deallo, N. Cartago, J. Velo, S. Garcia, and C. Javier, for their generous help throughout the project. This study was supported in part by JSPS KAKENHI Grant Numbers 20H03311 and 21H03651; the JSPS Core-to-Core CREPSUM JPJSCCB20200009; and the “Establishment of Global Research and Education Network in the Amami Islands” project of the Kagoshima University adopted by the Ministry of Education, Culture, Sports, Science and Technology, Japan. We thank the two anonymous reviewers for their comments that helped improve the quality of our study.

References

  • Allaria M (2016) Poissons de Mayotte. Guide Océan Indien, 388 pp.
  • Balisco RAT, Ticzon VS, Samaniego BR, Huang WC, Gonzales BJ, Liao TY (2023) Marine fishes of Palawan, Philippines: Species diversity, new records, and conservation status. Regional Studies in Marine Science 60: 102825. https://doi.org/10.1016/j.rsma.2023.102825
  • Böhlke EB (1997) Notes on the identity of elongate unpatterned Indo–Pacific morays, with description of a new species (Muraenidae, Subfamily Muraeninae). Proceedings of the Academy of Natural Sciences of Philadelphia 147: 89–109. http://www.jstor.org/stable/40650
  • Böhlke EB (2000) Notes on the identity of small, brown, unpatterned Indo–Pacific moray eels, with descriptions of three new species (Anguilliformes: Muraenidae). Pacific Science 54(4): 395–416.
  • Böhlke EB, McCosker JE (2001) The moray eels of Australia and New Zealand, with the description of two new species (Anguilliformes: Muraenidae). Records of the Australian Museum 53(1): 71–102. https://doi.org/10.3853/j.0067-1975.53.2001.1325
  • Böhlke EB, Randall JE (2000) A review of the moray eels (Anguilliformes: Muraenidae) of the Hawaiian Islands, with descriptions of two new species. Proceedings of the Academy of Natural Sciences of Philadelphia 150: 203–278.
  • Castle PHJ, McCosker JE (1986) Family No. 41: Muraenidae. Pp. 165–176, Pls. 7–8. In: Smith MM, Heemstra PC (Eds.) Smiths’ sea fishes, Springer Berlin, Heidelberg. https://doi.org/10.1007/978-3-642-82858-4
  • Chave EH, Mundy BC (1994) Deep-sea benthic fish of the Hawaiian Archipelago, Cross Seamount, and Johnston Atoll. Pacific Science 48(4): 367–409.
  • Chen HM, Shao KT, Chen CT (1994) A review of the muraenid eels (Family Muraenidae) from Taiwan with descriptions of twelve new records. Zoological Studies 33(1): 44–64.
  • Dor M (1984) Checklist of the fishes of the Red Sea. CLOFRES. Israel Academy of Sciences and Humanities, Jerusalem.
  • Eudeline R (2022) Illustrated checklist of Anguilliformes (Pisces, Teleostei) of the lagoon of Mayotte (Western Indian Ocean) with 14 new records. Marine and Fishery Sciences 35(1): 123–161. https://doi.org/10.47193/mafis.3512022010103
  • Fowler HW, Steinitz H (1956) Fishes from Cyprus, Iran, Iraq, Israel and Oman. Bulletin of the Research Council of Israel 5B(3–4): 260–292.
  • Fricke R (1999) Fishes of the Mascarene Islands (Réunion, Mauritius, Rodriguez): an annotated checklist with descriptions of new species. Koeltz Scientific Books, Koenigstein, Germany, 759 pp.
  • Fricke R, Mulochau T, Durville P, Chabanet P, Tessier E, Letourneur Y (2009) Annotated checklist of the fish species (Pisces) of La Réunion, including a Red List of threatened and declining species. Stuttgarter Beiträge zur Naturkunde A. Neue Serie 2: 1–168.
  • Fricke R, Kulbicki M, Wantiez L (2011) Checklist of the fishes of New Caledonia, and their distribution in the Southwest Pacific Ocean (Pisces). Stuttgarter Beiträge zur Naturkunde A. Neue Serie 4: 341–463.
  • Golani D, Fricke R (2018) Checklist of the Red Sea fishes with delineation of the Gulf of Suez, Gulf of Aqaba, endemism and Lessepsian migrants. Zootaxa 4509(1): 1–215. https://doi.org/10.11646/zootaxa.4509.1.1
  • Goren M, Dor M (1994) An updated checklist of the fishes of the Red Sea. CLOFRES II. The Israel Academy of Sciences and Humanities, Jerusalem, 120 pp.
  • Herre AW (1923) A review of the eels of the Philippine Archipelago. Philippine Journal of Science (23): 123–236.
  • Herre AW (1953) Check list of Philippine fishes. US Fish and Wildlife Service. Research Report No. 20, 977 pp.
  • Ho HC, Smith DG, McCosker JE, Hibino Y, Loh KH, Tighe KA, Shao KT (2015) Annotated checklist of eels (orders Anguilliformes and Saccopharyngiformes) from Taiwan. Zootaxa 4060(1): 140–189. https://doi.org/10.11646/zootaxa.4060.1.16
  • Huang WC, Mohapatra A, Thu PT, Chen HM, Liao TY (2020) A review of the genus Strophidon (Anguilliformes: Muraenidae), with description of a new species. Journal of Fish Biology 97(5): 1462–1480. https://doi.org/10.1111/jfb.14514
  • Huang WC, Smith DG, Loh KH, Liao TY (2021) Two new moray eels of genera Diaphenchelys and Gymnothorax (Anguilliformes: Muraenidae) from Taiwan and the Philippines. Zoological Studies 60: e24. https://doi.org/10.6620/ZS.2021.60-24
  • Huang WC, Liao TY, Tan HH (2023a) Uropterygius cyamommatus, a new moray eel (Anguilliformes: Muraenidae) from anchialine caves in Christmas Island, Australia, and Panglao Island, the Philippines. Raffles Bulletin of Zoology 71: 268–278. https://doi.org/10.26107/RBZ-2023-0021
  • Huang WC, Balisco RA, Evacitas FC, Liao TY (2023b) Description of a new moray eel (Anguilliformes: Muraenidae) from the Philippines, with a preliminary assessment of genetic and morphological variations of the Uropterygius concolor species complex. Journal of Fish Biology 103(3): 1–10. https://doi.org/10.1111/jfb.15472
  • Jeong B, Motomura H (2021) An annotated checklist of marine and freshwater fishes of five islands of Mishima in the Osumi Islands, Kagoshima, southern Japan, with 109 new records. Bulletin of the Kagoshima University Museum 16: 1–116.
  • Jordan DS, Seale A (1907) Fishes of the islands of Luzon and Panay. Bulletin of the Bureau of Fisheries 26(1): 1–48.
  • Kang CB, Kim MJ, Kim JK, Song CB (2020) New record of a moray eel, Strophidon dorsalis (Muraenidae, Anguilliformes) from Korea. Korean Journal of Ichthyology 32(3): 191–196. https://doi.org/10.35399/ISK.32.3.9
  • Khalaf MA, Disi AM (1997) Fishes of the Gulf of Aqaba. Publications of the Marine Science Station Aqaba 8: 1–252.
  • Kottelat M (2013) The fishes of the inland waters of southeast Asia: A catalogue and core bibliography of the fishes known to occur in freshwaters, mangroves and estuaries. Raffles Bulletin of Zoology (Suppl. 27): 1–663.
  • Kumar R, Dineshbabu AP, Jaiswar AK, Shenoy L, Kumar AP, Rahangdale S, Vase VK, Damodar D, Bharadiya S, Gohel J (2020) New geographical record for muraenid eels (Anguilliformes: Muraenidae) along the northeast Arabian Sea, Western Indian Ocean. Thalassas 36(2): 365–370. https://doi.org/10.1007/s41208-020-00215-x
  • Laboute P, Grandperrin R (2000) Poissons de Nouvelle-Calédonie. Éditions Catherine Ledru, Nouméa, 520 pp.
  • Loh KH, Shao KT, Ho HC, Lim PE, Chen HM (2015) A new species of moray eel (Anguilliformes: Muraenidae) from Taiwan, with comments on related elongate unpatterned species. Zootaxa 4060(1): 30–40. https://doi.org/10.11646/zootaxa.4060.1.5
  • Manilo LG, Bogorodsky SV (2003) Taxonomic composition, diversity and distribution of coastal fishes of the Arabian Sea. Journal of Ichthyology 43(1): 75–149.
  • McClelland J (1844) Apodal fishes of Bengal. Calcutta Journal of Natural History 5(18): 151–226.
  • McCosker JE, Randall JE (1982) Synonymies of Indian Ocean eels, with the description of Gymnothorax enigmaticus, a moray previously known as G. ruppeli. Proceedings of the California Academy of Sciences 43(2): 17–24.
  • Mohapatra A, Ray D, Smith DG, Mishra SS (2016) A new species of elongate unpatterned moray eel of the genus Gymnothorax (Muraenidae: Muraeninae) from the Bay of Bengal. Zootaxa 4150(5): 591–598. https://doi.org/10.11646/zootaxa.4150.5.6
  • Mohapatra A, Tudub PC, Mohantya SR, Mishra SS (2021) First report of three eel species (Order: Anguilliformes) from Andhra Pradesh coast, India. Indian Journal of Geo-Marine Sciences 50(05): 419–422. https://doi.org/10.56042/ijms.v50i05.66239
  • Motomura H, Harazaki S (2017) Annotated checklist of marine and freshwater fishes of Yaku-shima island in the Osumi Islands, Kagoshima, southern Japan, with 129 new records. Bulletin of the Kagoshima University Museum 9: 1–183.
  • Motomura H, Ishikawa S (2013) Fish collection building and procedures manual: English edition. The Kagoshima University Museum, Kagoshima and the Research Institute for Humanity and Nature, Kyoto, 70 pp.
  • Motomura H, Dewa S, Furuta K, Matsuura K (Eds.) (2013) Fishes of Iwo-jima and Take-shima islands, Mishima, Kagoshima, Japan. Kagoshima University Museum, Kagoshima and National Museum of Nature and Science, Tsukuba, 390 pp.
  • Motomura H, Alama UB, Muto N, Babaran RP, Ishikawa S (Eds.) (2017) Commercial and bycatch market fishes of Panay Island, Republic of the Philippines. Kagoshima University Museum, Kagoshima, University of the Philippines Visayas, Iloilo, and Research Institute for Humanity and Nature, Kyoto.
  • Motomura H, Hagiwara K, Senou H, Nakae M (Eds.) (2019) Identification guide to fishes of the Amami Islands in the Ryukyu Archipelago, Japan. Minaminippon Shimbun Kaihatsu Center, Kagoshima, 436 pp.
  • Mundy BC (2005) Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology No. 6, 704 pp.
  • Myers RF, Donaldson TJ (2003) The fishes of the Mariana Islands. Micronesica 35–36: 598–652.
  • Nakabo T (2002) Fishes of Japan with Pictorial Keys to the Species. Third Edition (English Version). Tokai University Press, 866 pp.
  • Nakae M, Motomura H, Hagiwara K, Senou H, Koeda K, Yoshida T, Tashiro S, Jeong B, Hata H, Fukui Y, Fujiwara K, Yamakawa T, Aizawa M, Shinohara G, Matsuura K (2018) An annotated checklist of fishes of Amami-oshima Island, the Ryukyu Islands, Japan. Memoirs of the National Museum of Nature and Science, Tokyo 52: 205–361.
  • Playfair RL, Günther A (1867) The fishes of Zanzibar, with a list of the fishes of the whole east coast of Africa. John van Voorst, London, 220 pp.
  • Psomadakis PN, Osmany HB, Moazzam M (2015) Field identification guide to the living marine resources of Pakistan. FAO species identification guide for fishery purposes. FAO, Rome, 486 pp.
  • Quindo JPV, Bucol AA (2019) Recent record of the tiger freshwater moray Gymnothorax polyuranodon, and an updated location list for the Philippines. Southeast Asia Vertebrate Records 2019: 48–49.
  • Ramos-Castro M, Chen HM, Mao BS (2020) Descriptions of neurocranium morphology in 34 species of moray eels (Muraenidae) found in Taiwan. Zootaxa 4810(1): 81–109. https://doi.org/10.11646/zootaxa.4810.1.4
  • Randall JE (1995) Coastal fishes of Oman. University of Hawaii Press, Honolulu, HI, USA, 439 pp.
  • Randall JE (2007) Reef and shore fishes of the Hawaiian Islands. University of Hawai’i, Sea Grant College Program, Honolulu, HI, USA, 560 pp.
  • Randall JE, Golani D (1995) Review of the moray eels (Anguilliformes: Muraenidae) of the Red Sea. Bulletin of Marine Science 56(3): 849–880.
  • Randall JE, Lim KKP (Eds.) (2000) A checklist of the fishes of the South China Sea. Raffles Bulletin of Zoology Supplement No. 8: 569–667.
  • Randall JE, Aida K, Oshima Y, Hori K, Hashimoto Y (1981) Occurrence of a crinotoxin and hemagglutinin in the skin mucus of the moray eel Lycodontis nudivomer. Marine Biology 62(2): 179–184. https://doi.org/10.1007/BF00388181
  • Randall JE, Williams JT, Smith DG, Kulbicki M, Mou Tham G, Mou TG, Labrosse P, Kronen M, Clua E, Mann BS (2004) Checklist of the shore and epipelagic fishes of Tonga. Atoll Research Bulletin (502): 1–35. https://doi.org/10.5479/si.00775630.502.1
  • Ray D, Mohapatra A, Smith DG (2015) A new species of short brown unpatterned moray eel of the genus Gymnothorax (Anguilliformes: Muraenidae) from the Bay of Bengal. Zootaxa 4027(1): 140. https://doi.org/10.11646/zootaxa.4027.1.8
  • Seale A (1917) New species of apodal fishes. Bulletin of the Museum of Comparative Zoology 61(4): 79–94.
  • Smith JLB (1962) The moray eels of the western Indian Ocean and the Red Sea. Ichthyological Bulletin No. 23: 421–444.
  • Smith DG, Böhlke EB (1997) A Review of the Indo–Pacific banded morays of the Gymnothorax reticularis group, with descriptions of three new species (Pisces, Anguilliformes, Muraenidae). Proceedings of the Academy of Natural Sciences of Philadelphia 148: 177–188.
  • Smith DG, Böhlke EB (2022) Family Muraenidae, Moray eels. Pp. 37–79. In: Heemstra PC, Heemstra E, Ebert DA, Holleman W, Randall JE (Eds.) Coastal fishes of the western Indian Ocean. Volume 2. South African Institute for Aquatic Biodiversity, Makhanda, South Africa, 614 pp.
  • Smith DG, Hibino Y, Ho HC (2018) Two new elongate unpatterned moray eels from Taiwan and Vietnam, with notes on two congeners (Anguilliformes: Muraenidae). Zootaxa 4454(1): 33–42. https://doi.org/10.11646/zootaxa.4454.1.5
  • Smith DG, Bogorodsky SV, Mal AO, Alpermann TJ (2019) Review of the moray eels (Anguilliformes: Muraenidae) of the Red Sea, with description of a new species. Zootaxa 4704(1): 1–87. https://doi.org/10.11646/zootaxa.4704.1.1
  • Snyder JO (1904) A catalogue of the shore fishes collected by the steamer Albatross about the Hawaiian Islands in 1902. Bulletin of the United States Fish Commission 22(1): 513–538.
  • Tsukamoto K, Watanabe S, Kuroki M, Aoyama J, Miller MJ (2014) Freshwater habitat use by a moray eel species, Gymnothorax polyuranodon, in Fiji shown by otolith microchemistry. Environmental Biology of Fishes 97(12): 1377–1385. https://doi.org/10.1007/s10641-014-0228-9
  • Uchida RN, Uchiyama JH (1986) Fishery atlas of the Northwestern Hawaiian Islands. NOAA Technical Report No. 38: 136–142.
  • Wagey BT, Bucol AA, Katuuk V (2015) The moray eel fishery in the seagrass beds of Siquijor Island, central Philippines, with remarks on two new Philippine records of the genus Gymnothorax. IAMURE International Journal of Ecology and Conservation 13(1): 1–13. https://doi.org/10.7718/ijec.v13i1.853
  • Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005) DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 360(1462): 1847–1857. https://doi.org/10.1098/rstb.2005.1716
  • Yoshida T, Motomura H, Musikasinthorn P, Matsuura K (2013) Fishes of northern Gulf of Thailand. National Museum of Nature and Science, Tsukuba, Research Institute for Humanity and Nature, Kyoto, and Kagoshima University Museum, Kagoshima, 239 pp.
login to comment