Research Article |
|
Corresponding author: Maria Celia D. Malay ( mdmalay@up.edu.ph ) Academic editor: Ronald Fricke
© 2023 Roxanne A. Cabebe-Barnuevo, El Andro A. Obar, Dianne Frances A. Penuela, Hiroyuki Motomura, Ricardo P. Babaran, Maria Celia D. Malay.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Cabebe-Barnuevo RA, Obar EAA, Penuela DFA, Motomura H, Babaran RP, Malay MCD (2023) Two new records of moray eels representing genera Gymnothorax and Strophidon (Actinopterygii: Anguilliformes: Muraenidae) from the Philippines. Acta Ichthyologica et Piscatoria 53: 217-226. https://doi.org/10.3897/aiep.53.108838
|
In this study, we report the collection of moray eel species Gymnothorax nudivomer (Günther, 1867) and Strophidon dorsalis (Seale, 1917) from the Western Visayas region, Philippines. Both represent new records for the country. A single specimen of G. nudivomer measuring 619 mm total length (TL) was collected from Iloilo Fish Port Complex, Iloilo and a specimen of S. dorsalis measuring 777 mm TL was collected from the fish market of Batan, Aklan. Detailed morphological descriptions and mitochondrial cytochrome oxidase I (COI) barcode sequences are provided. A comprehensive list of geographic records for both species, as well as a list of all species representing the genera Gymnothorax and Strophidon reported in the Philippines is also provided in this report.
new country records, moray eel, morphology, Panay Island, taxonomy
The family Muraenidae is considered one of the more diverse eel groups, having 228 valid species belonging to 16 genera (
Moray eels are widely distributed in tropical and subtropical seas. The majority of species are found in coral reefs, shallow-water rocky areas, and moderately deep habitats down to 500 m, while a few species inhabit brackish coastal waters, rivers, or anchialine caves (e.g.,
Two new Philippine records of moray eels and their partial cytochrome oxidase I (COI) DNA sequences are reported in this study. One of the new records, Gymnothorax nudivomer (Günther, 1867), belongs to a large genus (143 valid species;
Fish specimens were bought directly from the Iloilo Fish Port Complex (IFPC), Iloilo Province, and the fish market in Batan, Aklan Province (Figs
The fish muscle tissue samples were collected from the nape area on the right side of the body and preserved in absolute ethanol. DNA extractions were carried out according to the instructions of the GF-1 Nucleic Acid Extraction Kit (Vivantis Technologies Sdn. Bhd, Malaysia). The combination of the forward and reverse primers below designed by
FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′
FishR1-5′TAGACTTCTGGG TGGCCAAAGAATCA3′
The 25 μL PCR reaction was composed of 18.4 μL nuclease-free water, 2.25 μL 10× buffer, 1.25 μL MgCl2 (25 mM), 0.5 μL dNTP mix (10 mM), 0.25 μL of each primer, 0.1 μL Taq DNA polymerase (Vivantis Technologies Sdn. Bhd, Malaysia), and 2 μL DNA template. The PCR thermocycling conditions used are as follows: initial step at 95°C for 2 min, 35 cycles of 94°C for 30 s (denaturation), 54°C for 30 s (annealing), and 72°C for 1 min (extension), with a final extension at 72°C for 10 min. The PCR products were visualized using 1% agarose gel with gel red. Purification of PCR products was carried out using GF-1 PCR Clean-up Kit. The genomic DNA was quantified using a MultiSkanTM Skyhigh Microplate Spectrophotometer (Thermo Fisher Scientific). The PCR products were sent to Macrogen Inc. (South Korea) for sequencing. The forward and reverse sequences were checked, trimmed, and realigned using Unipro UGENE software (
Family Muraenidae Rafinesque, 1810
Genus Gymnothorax Bloch, 1795
Body elongated, large; tapering towards caudal area. Head large; eyes moderate in size, and situated slightly closer to snout (19% of HL) than rear of lower jaw (22% of HL, see Table
Morphological counts and measurements of Gymonothorax nudivomer and Strophidon dorsalis expressed in absolute and relative values.
| Character |
G. nudivomer |
S. dorsalis |
|---|---|---|
| Counts | ||
| Supraorbital pores | 3 | 3 |
| Infraorbital pores | 4 | 4 |
| Preoperculo-mandibular pores | 6 | 6 |
| Branchial pores | 1 | 2 |
| Vomerine teeth | Absent | 4 |
| Intermaxillary teeth | 7 | 6 |
| Median Intermaxillary teeth | 1 | 3 |
| Inner maxillary teeth | — | 5 |
| Inner dentary teeth | — | 4 |
| Measurements. Absolute values [mm] | ||
| Total length (TL) | 619 | 777 |
| Head length (HL) | 78 | 95 |
| Measurements. Relative values [%TL] | ||
| Head length | 14 | 12 |
| Body depth at gill opening | 10 | 4 |
| Body depth at anus | 8 | 4 |
| Pre-dorsal length | 10 | 8 |
| Pre-anal length | 43 | 43 |
| Measurements. Relative values [%HL] | ||
| Length of upper jaw | 45 | 32 |
| Length of lower jaw | 45 | 30 |
| Snout length | 19 | 11 |
| Eye diameter | 8 | 6 |
| Interorbital width | 15 | 7 |
| Distance between eye and snout | 19 | 11 |
| Distance between eye and rear of lower jaw | 22 | 18 |
Body yellow to light brown, becoming darker on caudal area; covered entirely with white spots of varying sizes; white spots on head and anterior body area very small, becoming large towards caudal area; white spots on dorsal and anal fins similar in body spots; white spots on caudal area composed of both rounded and irregular in shape; posterior margin of caudal fin white; eyes with vertical black bar; inner mouth bright yellow; gill opening black.
Body light brown, becoming darker on caudal area; white spots still visible; posterior margin of caudal fin white; inner mouth white; gill opening black.
Widely distributed across the Indo–Pacific Ocean. Specific reports are summarized in Table
Published reports on the occurrence of Gymnothorax nudivomer and Strophidon dorsalis along with their synonyms, organized chronologically by year of publication.
| Species | Status | Location | Reference |
|---|---|---|---|
| Gymnothorax nudivomer | |||
| Muraena nudivomer | Original name | Zanzibar |
|
| Lycodontis nudivomer | Junior synonym | Red Sea |
|
| Mozambique (Inhaca) |
|
||
| Gymnothorax xanthostomus | Junior synonym | Hawaiian Islands |
|
| Gymnothorax insignis | Junior synonym | Mauritius |
|
| Gymnothorax nudivomer | Valid name | Red Sea |
|
| North Pacific Ocean (Hawaii; Johnston Islands) |
|
||
| Taiwan (Nanfangao, Hualien and Taitung counties) | Chen at al. 1994; |
||
| Indian Ocean (Mauritius and East Africa from Zanzibar to Transkei, Mascarene Islands, Mayotte) |
|
||
| Gulf of Oman |
|
||
| New Caledonia |
|
||
| South Pacific Ocean (Marquesas Islands) |
|
||
| Australia (From Cape York to the southeastern border of Queensland) |
|
||
| Japan (Kochi Prefecture, Okinawa Islands, Osumi Islands (Iwo-jima Island and Yakushima Island), Amami-oshima Island) |
|
||
| Marianas Islands |
|
||
| Arabian Sea (Coast of Oman, Gulf of Aden, Eastern Coast of Somali) |
|
||
| Tonga Island |
|
||
| Yemen (Socotra Archipelago) |
|
||
| Philippines (Iloilo Province) | Presently reported study | ||
| Strophidon dorsalis | |||
| Gymnothorax dorsalis | Original name | Hongkong |
|
| Malaysia |
|
||
| Taiwan |
|
||
| South China Sea |
|
||
| Thailand (Prachuap Khiri Khan) |
|
||
| Indian waters (Bengal Bay, West coast of India) |
|
||
| Pakistan |
|
||
| Strophidon dorsalis | Valid name | Taiwan (Pingtung County, Kaohsiung City) |
|
| Vietnam (Nha Trang, Da Nang, Thua Thien-Hue Province) |
|
||
| India (West Bengal Coast, Odisha) |
|
||
| Korea (Jindo Island) |
|
||
| Philippines (Aklan Province) | Presently reported study | ||
A COI sequence fragment measuring 605 basepairs (bp) was submitted to GenBank under accession number OR214978.
Gymnothorax nudivomer was originally described as Muraena nudivomer from the Zanzibar Archipelago by Günther (
List of species under the genera Gymnothorax and Strophidon reported in Philippine waters.
| Species | Reference |
|---|---|
| Genus Gymnothorax | |
| G. angusticauda (Weber et de Beaufort, 1916) |
|
| G. annulatus Smith et Böhlke, 1997 |
|
| G. castlei Böhlke et Randall, 1999 |
|
| G. chilospilus Bleeker, 1864 |
|
| G. chlamydatus Snyder, 1908 |
|
| G. enigmaticus McCosker et Randall, 1982 |
|
| G. favagineus Bloch et Schneider, 1801 |
|
| G. fimbriatus (Bennett, 1832) |
|
| G. flavimarginatus (Rüppell, 1830) |
|
| G. fuscomaculatus (Schultz, 1953) |
|
| G. herrei Beebe et Tee-Van, 1933 |
|
| G. isingteena (Richardson, 1845) |
|
| G. kidako (Temminck et Schlegel, 1846) |
|
| G. margaritophorus Bleeker, 1864 |
|
| G. meleagris (Shaw, 1795) |
|
| G. microstictus Böhlke, 2000 |
|
| G. minor (Temminck et Schlegel, 1846) |
|
| G. monochrous (Bleeker, 1856) |
|
| G. monostigma (Regan, 1909) |
|
| G. nudivomer (Günther, 1867) | Presently reported study |
| G. phasmatodes (Smith, 1962) |
|
| G. philippinus Jordan et Seale, 1907 |
|
| G. pictus (Ahl, 1789) |
|
| G. pindae Smith, 1962 |
|
| G. polyuranodon (Bleeker, 1854) |
|
| G. prionodon Ogilby, 1895 |
|
| G. pseudoherrei Böhlke, 2000 |
|
| G. pseudokidako Huang, Loh et Liao, 2021 |
|
| G. pseudothyrsoideus (Bleeker, 1853) |
|
| G. punctatofasciatus Bleeker, 1863 |
|
| G. richardsonii (Bleeker, 1852) |
|
| G. robinsi Böhlke, 1997 |
|
| G. rueppelliae (McClelland, 1844) |
|
| G. thyrsoideus (Richardson, 1845) |
|
| G. tile (Hamilton, 1822) |
|
| G. undulatus (Lacepède, 1803) |
|
| G. zonipectis Seale, 1906 |
|
| Genus Strophidon | |
| S. dorsalis (Seale, 1917) | Presently reported study |
| S. sathete (Hamilton, 1822) |
|
| S. tetraporus Huang, Mohapatra, Thu, Chen et Liao, 2020 |
|
This fish is commonly known as the yellowmouth moray and can be easily identified by its tapering body form, white spots scattered throughout the body, and yellow coloration inside the mouth. Gymnothorax elegans and G. nudivomer are closely related species (
Family Muraenidae Rafinesque, 1810
Genus Strophidon McClelland, 1844
Body elongated and cylindrical, becoming compressed behind anus towards tail area. Head moderately long with wrinkled skin. Eyes moderate in size, and situated closer to snout (11% of HL) than rear of lower jaw (18% of HL, see Table
Body brown becoming dark towards caudal area; margins of dorsal and anal fins dark brown; caudal fins dark brown to black.
Body uniformly dark brown; fins dark brown to black.
Tropical to subtropical Indo–West Pacific Ocean. Specific reports are summarized in Table
A 568 bp COI sequence fragment was submitted to GenBank under accession number OR214977.
Strophidon dorsalis was originally placed in the genus Gymnothorax by
This species can be distinguished from its congeners based on the following combination of characters: body uniformly brown, anus located anterior to the midpoint of the body, 3–4 infraorbital pores, 2–7 inner maxillary teeth, 3–5 inner dentary teeth, 62–73 pre-anal vertebrae, and 155–174 total vertebrae (
The presently reported study provides two new country records of moray eels, Gymnothorax nudivomer and Strophidon dorsalis, from Philippine waters. Additionally, a list of geographic records for both species is provided, along with the list of all species under the two genera Gymnothorax and Strophidon documented in the country. The morphological descriptions and mitochondrial cytochrome oxidase I (COI) barcode sequences provided will aid in the more accurate identification of these species. Moreover, the findings expand our understanding of the distribution of these species and contribute to ongoing efforts to establish a comprehensive genetic library for marine fish species in the Philippines.
Due to a lack of studies, there are still many unreported marine fish species from the Philippines. Some of the recently reported species are presumed to have been overlooked because they share local names with similar-looking species. One of the best examples is the local name for all species of Strophidon found in Western Visayas, which is “nipa-nipa”. Therefore, we recommend assigning specific local names (standard names) to these newly-reported species to increase public awareness of their occurrence within the country, and help the scientific community distinguish between species. However, assigning Philippine local names requires additional research, including an updated compilation of all moray eels found in the country and their respective local names.
We gratefully acknowledge funding support from the UP System Emerging Inter-Disciplinary Research Program (OVPAA-EIDR-C08-011-R), the Leverage Fund from the Office of the Vice Chancellor for Research and Extension (OVCRE), University of the Philippines Visayas (2020-13-SP), and the Comission on Higher Education (CHED). We thank the Department of Agriculture, Bureau of Fisheries and Aquatic Resources (DA-BFAR), Provincial Government Unit, and the Office of Provincial Agriculture (PAO) from Aklan Province especially Ms. Grace-an Villareal Perlas (Aklan PAO staff), Sunshine Sucgang (field enumerator of the project), and BFAR staff at Iloilo Fish Port Complex (IFPC) for their administrative support, generous assistance and contributions throughout project. We are also grateful to the Philippine Genome Center-Visayas Satellite Facility (PGC-VSF), the National Institute of Molecular Biology and Biotechnology (UPV-NIMBB), and the UPV Museum of Natural Sciences (UPV-MNS). Our gratitude and appreciation to E. Delloro Jr., K.D. Barnuevo, M.V. Aranjuez, N. Ylaron, D. Mediodia, L. Mooc, C. Garinggan, J. Ariñez, A.G. Deallo, N. Cartago, J. Velo, S. Garcia, and C. Javier, for their generous help throughout the project. This study was supported in part by JSPS KAKENHI Grant Numbers 20H03311 and 21H03651; the JSPS Core-to-Core CREPSUM JPJSCCB20200009; and the “Establishment of Global Research and Education Network in the Amami Islands” project of the Kagoshima University adopted by the Ministry of Education, Culture, Sports, Science and Technology, Japan. We thank the two anonymous reviewers for their comments that helped improve the quality of our study.