Corresponding author: Seung-Woon Yun ( sjaksysw@hanmail.net ) Corresponding author: Karel Janko ( janko@iapg.cas.cz ) Academic editor: Jan Kotusz
© 2021 Seung-Woon Yun, Jong-Young Park, Karel Janko.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yun S-W, Park J-Y, Janko K (2021) Cross-species amplification of microsatellites and identification of polyploid hybrids by allele dosage effects in Cobitis hankugensis × Iksookimia longicorpa hybrid complex (Actinopterygii: Cypriniformes: Cobitidae). Acta Ichthyologica et Piscatoria 51(2): 167-174. https://doi.org/10.3897/aiep.51.63591
|
During the course of evolution, numerous taxa abandoned canonical sex and reproduced asexually. Examination of the Cobitis hankugensis × Iksookimia longicorpa asexual complex already revealed important evolutionary discoveries tackling phenomena like interspecific hybridization, non-Mendelian inheritance, polyploidy, and asexuality. Yet, as in other similar cases, the investigation is hampered by the lack of easily accessible molecular tools for efficient differentiation among genomotypes. Here, we tested the cross-species amplification of 23 microsatellite markers derived from distantly related species and investigated the extent to which such markers can facilitate the genome identification in the non-model hybrid complex. We found that 21 out of 23 microsatellite markers were amplified in all genomotypes. Five of them could be used for easy diagnostics of parental species and their hybrids due to species-specific amplification profiles. We also noted that three markers, i.e., IC654 and IC783 derived from Cobitis choii Kim et Son, 1984 and Iko_TTA01 from Iksookimia koreensis (Kim, 1975), had dosage-sensitive amplification efficiencies of species-specific alleles. This could be further used for reliable differentiation of genome composition in polyploids. The presently reported study introduces a noninvasive method applicable for the diagnosis of ploidy and genome composition of hybrids, which are not clearly distinguished morphologically. We showed that very detailed information may be obtained even from markers developed in distantly related taxa. Hybridization is being increasingly recognized as a driving force in evolution. Yet, proper detection of hybrids and their ploidy is particularly challenging, especially in non-model organisms. The present paper evaluates the power of microsatellite cross-amplification not only in the identification of hybrid forms but also in estimating their genome dosage on an example of a fish taxon that involves asexuality, hybridization as well as ploidy variation. It thus demonstrates the wide applicability of such cheap and non-invasive tools.
Microsatellites, cross-amplification, Iksookimia longicorpa × Cobitis hankugensis complex, hybridization, asexual reproduction, polyploidy
Although initially neglected in zoological literature, hybridization and polyploidy are attracting considerable research interest as mighty evolutionary mechanisms. Both phenomena are further linked with aberrant reproductive modes leading to the so-called asexual lineages with more or less severe deviations from canonical Mendelian reproduction (
The hybridization between Cobitis hankugensis and its confamilial relative Iksookimia longicorpa was first reported at the Nakdong River tributaries by
Although studies of this complex may bring discoveries of general importance, they are complicated by nontrivial morphological identification of the three types of hybrids. Cytological and molecular biological approaches are therefore required for their accurate discrimination. However, while diploid and triploid forms may be easily discriminated through the measurement of erythrocyte cell size or by flow cytometry, the two types of triploids may not be discriminated by the flow cytometry due to the absence of significant differences in DNA content between the parental species. Chromosomal counting thus remains the most reliable differentiation method to date, but it has a fatal disadvantage of being extremely timely and invasive. For these reasons, a new approach is needed for further study of the hybrid complex.
Microsatellite loci analysis, one of the most widely used molecular biology research methods, is an accurate tool for verifying genealogy and identification of relatives, as well as demonstrating genetic diversity by separating and analyzing markers that are inherent in each chromosome (
Sampled fish were treated according to the “Ethical justification for the use and treatment of fishes in research” (
The identification of collected specimens was based on previously published methods. In particular, we examined each specimen by morphology, which is known to consistently distinguish both parental species from each other as well as their hybrids (albeit, we stress that morphological analysis may not reliably distinguish among different genomotypes of hybrids) (
Finally, to obtain comparative material with known origin and genome composition, we have also performed 4 experimental crosses of parental species to obtain strict F1 HL hybrids, and we also crossed natural diploid HL hybrid females with either LL (3 families) or HH (3 families) males to obtain triploid HHL and HLL hybrids, altogether yielding a total of 133 experimental progeny of verified origin for microsatellite genotyping.
For the cross-species amplification analysis, the aforementioned fish samples were scrutinized for previously published microsatellite markers developed for related species of the Cobitidae family. The list of loci is shown in Table
Details of 23 microsatellite markers used for Cobitis hankugensis × Iksookimia longicorpa hybrid detection. Cross-amplification results are indicated for both Iksookimia longicorpa, Cobitis hankugensis species. Five markers with suited properties for genomotype identification and dosage effects are highlighted in bold.
Locus | Primer sequence (5′ → 3′) | Repeat motif | Reference species | Accession No. | Reference species | Iksookimia longicorpa | Cobitis hankugensis | ||||
---|---|---|---|---|---|---|---|---|---|---|---|
N A | Allele size [bp] | N A* | Allele size [bp] | N A | Allele size [bp] | ||||||
Cota_006 | F: | HEX-GCAGGTACAGAACCCCGACATGG | TTG/CTAT | Cobitis taenia | EU276579 | 11 | 336–374 | 2 | 163–165 | 2 | 163–165 |
R: | AGTACGGCCCTATGGGGTTTGAC | (see |
|||||||||
Cota_025 | F: | 6-FAM-TGCGTTTACAAGATTCGTGTGGAC | CACG | EU276580 | 3 | 144–160 | 2 | 42–52 | 2 | 42–52 | |
R: | GCTGCATATGAGTAACATGTCTG | ||||||||||
Cota_032 | F: | 6-FAM-TGGTCATGACTGGCACACCGTC | TCTT | EU276582 | 2 | 232–236 | 2 | 271–290 | 4 | 271–301 | |
R: | AGGAGGTTTGAAGAAGGGCAAG | ||||||||||
Cota_033 | F: | HEX-TTTCTGAATCAAGAGCCCAGCAGT | AGAC | EU276583 | 3 | 211–235 | 2 | 203–207 | 1 | 207 | |
R: | AGATATGACATCCAATCACACGCT | ||||||||||
Cota_037 | F: | 6-FAM-GCACTCGAGTCGATTCGGTGGCGC | GA | EU276584 | 3 | 272–276 | 6 | 275–304 | 4 | 280–298 | |
R: | GTAATCAATCAGTCCAAAGCACTT | ||||||||||
Cota_093 | F: | 6-FAM-CCCTGGGAGTTCTCAGCAGGACTG | AC | EU276586 | 4 | 341–357 | 1 | 304 | 1 | 304 | |
R: | ATAATGCACATTGTTGGGCTGC | ||||||||||
IC248 | F: | HEX-CACTCTGAGGCGAAACTGGAG | CA | Cobitis choii | EU252088 | 24 | 123–187 | 6 | 117–148 | 4 | 107–119 |
R: | TCAAATCATATAGTGCAGCCAAGC |
(see |
|||||||||
IC252 | F: | HEX-AATGAGACGGGTAACTTGTGTATG | CA | EU252089 | 12 | 188–218 | 1 | 155 | 1 | 155 | |
R: | GCTGATCTATGATTGGTTGTGTC | ||||||||||
IC276 | F: | 6-FAM-GTAACTCCGGGCGTGTAACTCTG | GT | EU252090 | 14 | 82–114 | 1 | 70 | 1 | 70 | |
R: | CACTGTAGAACCCAGCCAAAACC | ||||||||||
IC372 | F: | 6-FAM-ACACGCACACCTATTACAACCTA | AC | EU252091 | 33 | 77–169 | 2 | 86–90 | 2 | 86–90 | |
R: | GATTTGCCAGTGTGCTAATTG | ||||||||||
IC434 | F: | 6-FAM-TCCACCATGACCATTTTTACATA | AC | EU252092 | 23 | 83–165 | 1 | 78 | 1 | 78 | |
R: | GGTGTCTGGATCTCATCTTGAA | ||||||||||
IC645 | F: | 6-FAM-CTCTGAGACAACTCGGTAGTCCC | CA | EU252095 | 19 | 161–225 | 1 | 189 | 1 | 189 | |
R: | CACATACATGGCCTGCAACAT | ||||||||||
IC654 | F: | HEX-TGAGCCGACACTAGAAACAGAGC | CA | EU252096 | 14 | 158–208 | 1 | 130 | 1 | 138 | |
R: | GACAAAGTGCAGGCACAGAATG | ||||||||||
IC783 | F: | HEX-GGAGAAGATGTGATGGAGATG | AC | EU252098 | 22 | 146–196 | 2 | 120–123 | 1 | 127 | |
R: | ATATTATGATGGGAAGACACGAC | ||||||||||
IC839 | F: | 6-FAM-TTGTTCCCCTCTGAAACCCAATC | CA | EU252100 | 13 | 99–125 | 5 | 92–110 | 5 | 82–94 | |
R: | GTGTTAGCCCGTGTGCCAAAG | ||||||||||
IC875 | F: | HEX-AGCGGTGTGGATGTGAATGCTAA | CA | EU252101 | 22 | 132–182 | – | 9 | 134–158 | ||
R: | CTTGTCAGGCTCTGGCACTCG | ||||||||||
Iko_AAT08 | F: | 6-FAM-GTGATGCAAATGTCTTCTGTGT | ATT | Iksookimia koreensis | KJ588473 | 5 | 147–163 | 2 | 125–135 | – | |
R: | CAAATCTTTCCTTTGTCTTTGG |
(see |
|||||||||
Iko_TTA01 | F: | 6-FAM-ACATTAGTGGGGTAAGATGTGC | TTA | KJ588474 | 8 | 180–238 | 1 | 321 | 1 | 330 | |
R: | AAGGAAGGAATAGGGTAAGCTG | ||||||||||
KN03 | F: | HEX-TTTGAGAATTGACAAAATCACTGC | CA | Koreocobitis naktongenesis | JN203057 | 8 | 134–156 | 1 | 116 | 1 | 116 |
R: | TGATATCATCGGTGTAAATGTTTAAGA | (see Anonymous 2011) | |||||||||
KN16 | F: | HEX-CGACGTAGAGTCAAAAGTGCG | CA | JN203058 | 10 | 135–157 | 1 | 126 | 1 | 126 | |
R: | TGGAGATCAGGTTACGGGTG | ||||||||||
KN20 | F: | HEX-TTGTGCTGATAACACATCCTGC | CA | JN203059 | 10 | 144–172 | 1 | 137 | 1 | 137 | |
R: | GATTGAATCATCCGCAGAGC | ||||||||||
KN25 | F: | 6-FAM-CGTTCCCCTCAGGTCTCAAT | CA | JN203060 | 9 | 275–295 | 4 | 293–313 | 4 | 307–313 | |
R: | CCTGCAGTTTTCAGCCAAGA | ||||||||||
KN34 | F: | 6-FAM-CCAGTGGACATCTGCAACAAC | TG | JN203062 | 9 | 273–289 | 1 | 286 | 1 | 286 | |
R: | GCCCTGCTAGTGAGGAACAA |
Study localities of Cobitis hankugensis × Iksookimia longicorpa hybrid complex used in this study.
No. | River basin | Locality | Coordinates |
1 | Ram Stream | Inwol-myeon, Namwon-si, Jeollabuk-do | 35°27′27.2″N, 127°36′25.6″E |
2 | Nam River | Saengcho-myeon, Sancheong-gun, Gyeongsangnam-do | 35°28′46.9″N, 127°50′56.9″E |
3 | Banseong Stream | Ibanseong-myeon, Jinju-si, Gyeongsangnam-do | 35°9′51.8″N, 128°17′44.8″E |
4 | Cheongdo Stream | Punggak-myeon, Cheongdo-gun, Gyeongsangbuk-do | 35°38′37.2″N, 128°37′25.8″E |
5 | Unjeong Stream | Muan-myeon, Miryang-si, Gyeongsangnam-do | 35°29′37.6″N, 128°40′11.1″E |
6 | Hwanggye Stream | Yongju-myeon, Hapcheon-gun, Gyeongsangnam-do | 35°30′20.3″N, 128°6′17.2″E |
7 | Oknyeodong Stream | Unam-myeon, Imsil-gun, Jeollabuk-do | 35°39′35.3″N, 127°9′20.0″E |
For DNA analysis a piece of pectoral fin was dissected from each specimen and stored in 100% ethyl alcohol. Total DNA was purified with the genomic DNA Prep Kit for blood and tissue (QIAGEN Co., USA). PCR reactions were completed in a total volume of 50 µL, consisting of 2 µL of genomic DNA, 1 µL of the 10 uM forward (fluorescently labeled) and reverse primer solutions, 24 µL of Premix Taq (Takara, Japan), and 22 µL of distilled water (Takara, Japan). Polymerase chain reactions for all specimens were executed in GeneAtlas G-02 thermocycler (Astec, Japan) with the initial denaturing step at 95°C for 5 min and 35 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C. A final extension step at 72°C for 5 min. The PCR amplicons were visualized on a 2% agarose gel stained with LoadingStar (Dyne, Korea) together with negative controls and Takara 1 KB molecular size ladder for preliminary size determination. The final PCR products were run on an ABI-3730XL sequencer (Applied Biosystems, USA) with the size standard at 350 ROX. The resulting electropherograms were analyzed in Peak Scanner v1.0 (Applied Biosystems, USA).
To evaluate whether particular markers bear consistent information about the allelic dosage in diploid and triploid hybrids, we used the Gene scan peak analysis with the Peak Scanner v1.0 (Applied Biosystems, USA) to analyze and compare the relative intensities of alleles in analyzed individuals.
Altogether, based on the classical determination methods including karyotype analysis we selected for marker validation 25 individuals of I. longicorpa, 25 of C. hankugensis, and also 5 HL, 5 HLL, and 5 HHL hybrid individuals. We further included into the analysis 59 natural hybrids (without karyotype analysis) sampled at five sites in the Nakdong River basin, and we also scrutinized 133 progenies generated by artificial crossing experiments with known origin and genomic composition.
The cross-amplification of 23 published markers showed that 19 loci were amplified in all genomotypes of the hybrid complex. Moreover, we further noticed that the IC875 marker did not amplify with I. longicorpa but it did amplify in the C. hankugensis and hybrids while the Iko_AAT08 marker did not amplify at C. hankugensis, but it did amplify in the I. longicorpa and in hybrids (Table
We note that in each locus, the numbers of detected alleles were always lower than those reported in the reference species for which given microsatellite marker has been developed and where 2–33 alleles per locus per species (mean 12.2) have been reported in the original publications. When compared to the reference species, analyzed hybrids had the highest numbers of alleles in markers taken from C. taenia (mean value 2.3 alleles per locus), the second-highest numbers of alleles in loci taken from C. choii (mean value 2.2), while the markers taken from different genera showed lowest numbers of alleles, i.e., mean value 1.5 in K. naktongensis markers and 1.4 in I. koreensis markers, respectively. This is in line with the general expectation that the efficiency of cross-species amplification tends to decrease with increasing phylogenetic distance between the reference species and the target species (
Nevertheless, we discovered three loci, which seem very useful for fast and efficient identification of genomotypes from the studied hybrid complex because they possess non-overlapping allelic size ranges between species. Specifically, the loci IC654, IC783, and Iko_TTA01 always distinguished between the specimens identified as pure I. longicorpa and C. hankugensis, respectively, while they always provided amplification products of both species in the hybrid individuals. Furthermore, we found two additional loci with selective amplification (IC875, Iko_AAT08), where one sexual species was characterized by absence of amplification, while the other species and all hybrid individuals provided specific amplification product (Table
This altogether suggests that tested cross-amplification identified three markers with species-specific allelic variants and two loci with species-selective amplification that may be used as haploid detection markers for C. hankugensis and I. longicorpa, respectively. In addition, some other loci also appear as useful for subsequent population genetic studies given they possess a moderate number of alleles per species, which may allow for frequency-based analyses.
Given that the scope of this paper was to find a fast and efficient method to discern parental species and hybrid genomotypes, we will describe in the following text the properties of three markers that we propose for such a purpose given their ability to diagnose both species as well as the ploidy of hybrid individuals. The IC654 and IC783 markers derived from C. choii and the Iko_TTA01 marker derived from I. koreensis were of particular interest for us as they were fixed for different alleles in both parental species and showed the consistent presence of both species-specific amplification products in hybrids with different relative peak intensities depending on the genotypes (Fig.
The patterns were straightforward in IC654 and Iko_TTA01 markers (Fig.
Demonstration of Microsatellite analysis of IC654 (A), Iko_TTA01 (B) and IC783 (C) loci in Cobitis hankugensis × Iksookimia longicorpa hybrid complex. Upper panels A–C show the electropherograms of the three loci in all biotypes. Boxplots in the lower panel depict for each locus the relative intensity (%) of the minor peak to the major one (D–F) and the mean relative values of the total of three markers for each genomotype (G).
To verify the possibility of applying the three selected markers (IC783, IC654, and Iko_TTA01) for the identification of unknown hybrid genomotype, we demonstrate the relative size ratio of the minor peak to the major one (Fig.
To date, the identification of C. hankugensis × I. longicorpa hybrid complex had a fatal disadvantage in that it requires complex processing and fish sacrifice. In this study, we provided a reliable identification method of the C. hankugensis × I. longicorpa hybrid complex using microsatellite markers through a single Genescan analysis using only a small piece of fin tissues. This has the great advantage that the fish are kept alive and can be used for additional hybridization experiments by reducing the stress.
Microsatellite markers have indeed been previously used to identify hybrid groups of fish, including the family Cobitidae, (e.g.,
In a summary, the cross-species amplification of microsatellite markers can be used as an easy and fast identification method in studies of reproductive modes of investigated hybrids.
This project has been supported by the Czech Science Foundation grant No. 17-09807S and the Ministry of Education, Youth and Sports of the Czech Republic, Grant/Award Number: EXCELLENCE CZ.02.1.01/0.0/0.0/ 15_003/0000460 OP RDE.